circad | circRNAs associated with diseases

hsa_circ_0109291
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Oral Squamous Cell Carcinoma	ICD-10	Carcinoma in situ of oral cavity, oesophagus and stomach (D00)
DBLink	Link to database	PMID	30483394
Experimental Method
Sample Type	Tissues and Cell lines	Comparison	Fifty-one pairs of OSCC tissues and adjacent normal tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TGCTGTCTCTAAGCAAGACCC Reverse AGGGTTCAGGCATTCCCACT	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Ouyang, SB, Wang, J, Zhao, SY, Zhang, XH, Liao, L (2018). CircRNA_0109291 regulates cell growth and migration in oral squamous cell carcinoma and its clinical significance. Iran J Basic Med Sci, 21, 11:1186-1191.